si:ch73-186j5.2

Ensembl ID:
ENSDARG00000018301
ZFIN ID:
ZDB-GENE-070705-214
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A5WW48]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17256 Nonsense Available for shipment Available now
sa13326 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033936 Nonsense 199 258 5 6
ENSDART00000148177 Nonsense 200 259 5 6
ENSDART00000033936 Nonsense 199 258 5 6
ENSDART00000148177 Nonsense 200 259 5 6
Genomic Location (Zv9):
Chromosome 18 (position 21908338)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22138561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCAGGCTGCACTGAACATGTTAACTSGCTGCTTGGCGGAGGATTTC[A/T]GAAAAGATGGCATTCTTGTTATCTCTCTCCATCCAGGATGGGTCCAGACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13326
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033936 Nonsense 199 258 5 6
ENSDART00000148177 Nonsense 200 259 5 6
ENSDART00000033936 Nonsense 199 258 5 6
ENSDART00000148177 Nonsense 200 259 5 6
Genomic Location (Zv9):
Chromosome 18 (position 21908338)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 22138561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTCAGGCTGCACTGAACATGTTAACTCGCTGCTTGGCGGAGGATTTC[A/T]GAAAAGATGGCATTCTTGTTATCTCTCTCCATCCAGGATGGGTCCAGACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link