pdpk1b

Ensembl ID:
ENSDARG00000018285
ZFIN ID:
ZDB-GENE-040426-1820
Description:
3-phosphoinositide dependent protein kinase-1b [Source:RefSeq peptide;Acc:NP_991262]
Human Orthologues:
AC141586.1, PDPK1
Human Descriptions:
3-phosphoinositide dependent protein kinase-1 [Source:HGNC Symbol;Acc:8816]
Putative 3-phosphoinositide-dependent protein kinase 2 [Source:UniProtKB/Swiss-Prot;Acc:Q6A1A2]
Mouse Orthologue:
Pdpk1
Mouse Description:
3-phosphoinositide dependent protein kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1338068]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17656 Essential Splice Site Available for shipment Available now
sa24545 Nonsense Available for shipment Available now
sa39462 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003789 Essential Splice Site 87 537 3 14
Genomic Location (Zv9):
Chromosome 24 (position 38834987)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37434205
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACAGGTTGTCTTGGCAAAGGAACACACGACGGGGAAGGAATATGCAA[G/A]TAAGTTGTCYTGTCATTTAGGGCTGTGCATTATGATGATGATGATNNNAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24545
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003789 Nonsense 109 537 4 14
Genomic Location (Zv9):
Chromosome 24 (position 38832918)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37432136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGCGCCACATAATGAAGGAGAATAAAGCGCAGTATGTCAAGAGAGAA[C/T]GAGACATAATGTCACACCTGGATCATCCGTTCTTCGTCAAACTCTACTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39462
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003789 Essential Splice Site 134 537 4 14
Genomic Location (Zv9):
Chromosome 24 (position 38832841)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 37432059
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTTCTTCGTCAAACTCTACTTCACCTTTCAGGACGAGGAGAAGCTGTG[T/A]ATCCTTCACACAAACTCTGATGCTCAACTAGTATGGGTTGCACAGCGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link