cyba

Ensembl ID:
ENSDARG00000018283
ZFIN ID:
ZDB-GENE-040426-1526
Description:
cytochrome b-245, alpha polypeptide [Source:RefSeq peptide;Acc:NP_956873]
Human Orthologue:
CYBA
Human Description:
cytochrome b-245, alpha polypeptide [Source:HGNC Symbol;Acc:2577]
Mouse Orthologue:
Cyba
Mouse Description:
cytochrome b-245, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:1316658]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43128 Nonsense Mutation detected in F1 DNA During 2016
sa11798 Nonsense Available for shipment Available now
sa43129 Nonsense Mutation detected in F1 DNA During 2016
sa11994 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa43128
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023539 Nonsense 66 185 3 6

The following transcripts of ENSDARG00000018283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 30962775)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31095720
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGTTTGCTTGAATATCCACGCAGCAAACGGGGCAAAGGCACCAGTATT[G/T]AGAGAAGGTAAGTGTTGATGAAAGCCAAGTTACAGGAAGTACAGGCTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11798
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023539 Nonsense 87 185 4 6

The following transcripts of ENSDARG00000018283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 30963002)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31095947
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACTGCTTTACAGTGTGTGTAAAATCTTTTGGACCCCTGACCAGAAACTA[T/A]TACGTCAGAGCTTTCTTACATGCTGCGTAAGTCGTCAGTCACRCCTTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43129
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023539 Nonsense 163 185 6 6

The following transcripts of ENSDARG00000018283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 30963810)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31096755
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCATCAAAGAACCTCCTCAAAACCCACCTCCCAGACCTCCCCCTGAACTG[C/T]GACGTAAAAAAGCAGATAACCTGGATGCTGCAGCATATGACAATCCTATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023539 Nonsense 175 185 6 6

The following transcripts of ENSDARG00000018283 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 30963848)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31096793
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCCCTGAACTGCGMCGTAAAAAAGCAGATAACCTGGATGCTGCAGCATA[T/G]GACAATCCTATGTCTGTCACCATCAACGAATAAAGATTTCCTAAMAGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link