olfm1a

Ensembl ID:
ENSDARG00000018270
ZFIN ID:
ZDB-GENE-040718-194
Description:
olfactomedin 1a [Source:RefSeq peptide;Acc:NP_001002491]
Mouse Orthologue:
Olfm1
Mouse Description:
olfactomedin 1 Gene [Source:MGI Symbol;Acc:MGI:1860437]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15214 Essential Splice Site Available for shipment Available now
sa221 Nonsense Confirmed mutation in F2 line During 2014
sa20573 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15214
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002908 None None 485 None 6
ENSDART00000051812 Essential Splice Site 22 125 None 4
ENSDART00000073950 Essential Splice Site 22 125 None 4
ENSDART00000134241 Essential Splice Site 22 457 None 6
ENSDART00000135610 None None 153 None 4
Genomic Location:
Chromosome 5 (position 68309673)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCCTGAGTCTCACCCTCCTGGTGCTGATGGGTACYGAACTCACCCAAG[T/A]AGGTTTTCAAACGCCATTTTCAGCGGGATAATTAAGCAGATAWGATCRTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa221
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002908 Nonsense 67 485 2 6
ENSDART00000051812 Nonsense 39 125 2 4
ENSDART00000073950 Nonsense 39 125 2 4
ENSDART00000134241 Nonsense 39 457 2 6
ENSDART00000135610 Nonsense 67 153 2 4
Genomic Location:
Chromosome 5 (position 68324390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGCTGCCTGCGAACCCTGAGGAGTCGTGGCAGGTGTACAGCTCAGCG[C/T]AGGACAGCGAGGGCAGGTGTGTGTGCACGGTTGTGGCTCCTCAGCAGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20573
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002908 Nonsense 276 485 6 6
ENSDART00000051812 None None 125 None 4
ENSDART00000073950 None None 125 None 4
ENSDART00000134241 Nonsense 248 457 6 6
ENSDART00000135610 None None 153 None 4
Genomic Location:
Chromosome 5 (position 68352461)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCACCAGGTGTGGTACATGGACGGCTACCACAACAATCGCTTCGTCCGC[G/T]AATACAAGTCCATGGCCGACTTCATGTATTCCGACAACTTCACCTCACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kk69blmk