si:dkey-1h6.1

Ensembl ID:
ENSDARG00000018266
ZFIN ID:
ZDB-GENE-041001-127
Description:
Novel protein similar to vertebrate methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methe
Human Orthologue:
MTHFD1
Human Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase
Mouse Orthologue:
Mthfd1
Mouse Description:
methylenetetrahydrofolate dehydrogenase (NADP+ dependent), methenyltetrahydrofolate cyclohydrolase,

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32295 Nonsense Available for shipment Available now
sa1702 Essential Splice Site Available for shipment Available now
sa43457 Essential Splice Site Mutation detected in F1 DNA During 2017
sa32296 Essential Splice Site Available for shipment Available now
sa23722 Nonsense Available for shipment Available now
sa37049 Nonsense Mutation detected in F1 DNA During 2017
sa14993 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32295
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199   None 935 None 30
ENSDART00000141697 Nonsense 14 900 2 26
Genomic Location (Zv9):
Chromosome 20 (position 27677085)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27748388
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTGCAGACATGTTTTCTGTCAGTGCTGCTGTGCTACGGCGAGGTGTTT[T/A]AAGGTACAGATGGGACAGATGCTGTGCGCTTGCAACAGTTGTTTCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1702
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199 Essential Splice Site 80 935 4 30
ENSDART00000141697 Essential Splice Site 101 900 5 26
Genomic Location (Zv9):
Chromosome 20 (position 27681819)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27753122
KASP Assay ID:
554-1648.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATCAATGCGAACCACATCAGGCTTCCTGAAACAGCCACTGAAAATGAAG[T/A]AAGAGAAACACAATAAATAACAACGTTTATCCATATATCATTGTTTTAAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa43457
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199 Essential Splice Site 475 935 14 30
ENSDART00000141697 Essential Splice Site 494 900 15 26
Genomic Location (Zv9):
Chromosome 20 (position 27695507)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27766810
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGACACTGTTAAAGCATATGCTCACTATGAGACCAAACTCTCGGAAAAGG[T/C]CAGGCTTGTGTTTGATATGTGGGTGTTTCTATAATTGGAGATACAGTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32296
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199 Essential Splice Site 725 935 23 30
ENSDART00000141697 Essential Splice Site 716 900 22 26
Genomic Location (Zv9):
Chromosome 20 (position 27701910)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27773213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATAGATCCAAGCAGGTTTGCCCCTTCCAAAAGAGTACTTACAAGAGG[T/C]AATACACTTTTACTACTGACAACATTGTGATAGATAGATAGATAGATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23722
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199 Nonsense 757 935 24 30
ENSDART00000141697 Nonsense 748 900 23 26
Genomic Location (Zv9):
Chromosome 20 (position 27702725)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27774028
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGAAAAAGCACAAGCATTCGGCTTGCCGGTGATCGTAGCTGTCAAC[A/T]AATTCAGGTAAAGCAGCAAGCAGCCAACAATGAAATATTTTGCTATTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37049
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199 Nonsense 787 935 25 30
ENSDART00000141697 Nonsense 778 900 24 26
Genomic Location (Zv9):
Chromosome 20 (position 27704788)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27776091
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCCAGGCGAGGCAGGCTGGTGCCTTTGATGCAGTGCAGTGCAGCAGCT[G/A]GTCTGAAGGGGGCGCTGGAGCTCTGGCTCTGGCCGAGACGGTTCAGAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14993
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008199 Nonsense 787 935 25 30
ENSDART00000141697 Nonsense 778 900 24 26
Genomic Location (Zv9):
Chromosome 20 (position 27704789)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27776092
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGCCAGGCGAGGCAGGCTGGTGCYTTTGATGCAGTGCAGTGCAGCAGCTG[G/A]TCTGAAGGGGGCGCTGGAGCTCTGGCTCTGGCCGAGACGGTTCAGAGAGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link