pdia2

Ensembl ID:
ENSDARG00000018263
ZFIN ID:
ZDB-GENE-040426-705
Description:
protein disulfide isomerase family A, member 2 [Source:RefSeq peptide;Acc:NP_957342]
Human Orthologue:
PDIA2
Human Description:
protein disulfide isomerase family A, member 2 [Source:HGNC Symbol;Acc:14180]
Mouse Orthologue:
Pdia2
Mouse Description:
protein disulfide isomerase associated 2 Gene [Source:MGI Symbol;Acc:MGI:1916441]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19434 Nonsense Available for shipment Available now
sa31193 Essential Splice Site Available for shipment Available now
sa32599 Nonsense Mutation detected in F1 DNA During 2017
sa10302 Nonsense Available for shipment Available now
sa13027 Nonsense Available for shipment Available now
sa15452 Nonsense Available for shipment Available now
sa12819 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19434
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Nonsense 138 555 2 11
ENSDART00000130181 Nonsense 119 518 3 12
Genomic Location (Zv9):
Chromosome 1 (position 9034576)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9274381
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTTGCCTCAGAGTTCAGTGTGGACAGTTTTCCCACTCTCAAATTCTTC[A/T]AAGAAGGAAACAGACAAAATGCCACTACTTTCTTTGGTAAAGTGTCTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31193
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Essential Splice Site 195 555 4 11
ENSDART00000130181 Essential Splice Site 176 518 5 12
Genomic Location (Zv9):
Chromosome 1 (position 9035729)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9275534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGAATCATGCAGTAGTTGAGTTCAATTTAATTATCTCCCTCTGCCCC[A/G]GGATTTGGAAGGAGAAAAGGCGAAGACATTCTATGATGTAACTTTAATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32599
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Nonsense 473 555 9 11
ENSDART00000130181 Nonsense 454 518 10 12
Genomic Location (Zv9):
Chromosome 1 (position 9038544)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9278349
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATTGCCAAAATGGACGCCACAGAAAATGATGTGGAAGATCTGACAATA[C/T]AGGGATTTCCCACAATTAAATACTTTCCTGCTGGGACCGAAAAAAAGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Nonsense 496 555 10 11
ENSDART00000130181 Nonsense 477 518 11 12
Genomic Location (Zv9):
Chromosome 1 (position 9040403)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9280208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTSGAAATAATGNAWTTTTTTTTAAAACAGATTGTTGACTRTGATGGAAAT[A/T]GAGATTTGGAGAYTTTCTCAAAGTTCCTGGAWAATGGAGGAGTTTTACCR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13027
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Nonsense 545 555 11 11
ENSDART00000130181 Nonsense 508 518 12 12
ENSDART00000005895 Nonsense 545 555 11 11
ENSDART00000130181 Nonsense 508 518 12 12
Genomic Location (Zv9):
Chromosome 1 (position 9040681)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9280486
KASP Assay ID:
2259-0224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTTTCTAATTTTTTAGYCAACAGACGAATCAAAAGAAGAGTCACCA[A/T]AAKCCACCAATGAAACCGACAAGGATGAGCTGTDAAAACAAGGCTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15452
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Nonsense 545 555 11 11
ENSDART00000130181 Nonsense 508 518 12 12
ENSDART00000005895 Nonsense 545 555 11 11
ENSDART00000130181 Nonsense 508 518 12 12
Genomic Location (Zv9):
Chromosome 1 (position 9040681)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9280486
KASP Assay ID:
2259-0224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTTTCTAATTTTTTAGYCAACAGACGAATCAAAAGAAGAGTCACCA[A/T]AAKCCACCAATGAAACCGACAAGGATGAGCTGTRAAAACAAGGCTTAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12819
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005895 Nonsense 545 555 11 11
ENSDART00000130181 Nonsense 508 518 12 12
ENSDART00000005895 Nonsense 545 555 11 11
ENSDART00000130181 Nonsense 508 518 12 12
Genomic Location (Zv9):
Chromosome 1 (position 9040681)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 9280486
KASP Assay ID:
2259-0224.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCTTTCTAATTTTTTAGYCAACAGACGAATCAAAAGAAGAGTCACCA[A/T]AAKCCACCAATGAAACCGACAAGGATGAGCTGTDAAAACAAGGCTTAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link