bmp7a

Ensembl ID:
ENSDARG00000018260
ZFIN ID:
ZDB-GENE-000208-25
Description:
bone morphogenetic protein 7a [Source:RefSeq peptide;Acc:NP_571396]
Human Orthologue:
BMP7
Human Description:
bone morphogenetic protein 7 [Source:HGNC Symbol;Acc:1074]
Mouse Orthologue:
Bmp7
Mouse Description:
bone morphogenetic protein 7 Gene [Source:MGI Symbol;Acc:MGI:103302]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1343 Nonsense Available for shipment Available now
sa15764 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016472 Nonsense 212 432 3 7
ENSDART00000143942 Nonsense 76 296 2 6
Genomic Location:
Chromosome 11 (position 7201463)
KASP Assay ID:
554-1257.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTGACCCTGCACAGGGAGCTGTACCTGCTGGACTCACGAGTGGTATG[G/A]GCTGCAGAAGAGGGATGGCTGGTCTTTGACCTCACGGTCACCAGTAACCA
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control; 10 hpf

Control; 10 hpf

zoom

Mutant; 10 hpf

Mutant; 10 hpf

zoom

Control; 10 hpf

Control; 10 hpf

zoom

Mutant; 10 hpf

Mutant; 10 hpf

zoom

Mutant; 10 hpf

Mutant; 10 hpf

zoom

Stage Entity Quality Tag
Segmentation:5-9 somites
ZFS:0000024
whole organism
ZFA:0001094
dorsalized
PATO:0000620
abnormal
PATO:0000460
Transcriptome Profiling Preview:
View complete transcriptome profile
Region 3' end position 3' end strand Adjusted p-value Log2 fold change (mutant/sibling) Closest Ensembl gene 3' end Gene name e74 Ensembl Gene ID
6:28626701-28628021 28628021 1 9.92 × 10-129 -4.8 0 tp63 ENSDARG00000044356
10:46360201-46360620 46360620 1 6.21 × 10-100 -3.4 -6 ved ENSDARG00000096498
5:38694901-38695615 38695615 1 1.22 × 10-78 -2.2 2 tagln2 ENSDARG00000033466
6:56150101-56151236 56151236 1 1.59 × 10-69 -2.0 0 tfap2c ENSDARG00000040606
6:31784203-31785100 31784203 -1 6.00 × 10-54 -2.3 0 BX664614.1 ENSDARG00000095311

Mutation Details

Allele Name:
sa15764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016472 Nonsense 218 432 3 7
ENSDART00000143942 Nonsense 82 296 2 6
Genomic Location:
Chromosome 11 (position 7201446)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCTGTACCTGCTGGACTCACGAGTGGTATGRGCTGCAGAAGAGGGAT[G/A]GCTRGTCTTTGACCTCACGGTCACCAGTAACCACTGGGTTATAAACCCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/pur12oy7