atp1a3a

Ensembl ID:
ENSDARG00000018259
ZFIN IDs:
ZDB-GENE-001212-7, ZDB-GENE-001212-8
Description:
ATPase, Na+/K+ transporting, alpha 3a polypeptide [Source:RefSeq peptide;Acc:NP_571759]
Human Orthologue:
ATP1A3
Human Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide [Source:HGNC Symbol;Acc:801]
Mouse Orthologue:
Atp1a3
Mouse Description:
ATPase, Na+/K+ transporting, alpha 3 polypeptide Gene [Source:MGI Symbol;Acc:MGI:88107]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa4783 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa4783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104950 Nonsense 317 1023 8 21
Genomic Location:
Chromosome 19 (position 6974706)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGGGCGTCAYCTTCTTCATCCTGTCCATCATCCTGGGCTACAGCTG[G/A]CTGGAGGCCGTCATCTTCCTCATCGGCATCATYGTGGCCAACGTGCCCGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/r3s7524e