adkb

Ensembl ID:
ENSDARG00000018258
ZFIN ID:
ZDB-GENE-030131-948
Description:
adenosine kinase b [Source:RefSeq peptide;Acc:NP_942097]
Human Orthologue:
ADK
Human Description:
adenosine kinase [Source:HGNC Symbol;Acc:257]
Mouse Orthologue:
Adk
Mouse Description:
adenosine kinase Gene [Source:MGI Symbol;Acc:MGI:87930]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6276 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa6276
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027234 Nonsense 113 345 5 11
ENSDART00000089385 Nonsense 113 345 5 11
Genomic Location (Zv9):
Chromosome 12 (position 47930257)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 46836815
KASP Assay ID:
554-5097.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGATCCTGARGCAGAAAGCAGCTGAAGCTCAYGTTGAYGCTCATTATTA[T/A]GAACAAAATCAASAACCCACAGGAACCTGTGCGGCCTGCATTACTGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link