ncoa1

Ensembl ID:
ENSDARG00000018257
ZFIN ID:
ZDB-GENE-041001-175
Description:
Novel protein similar to vertebrate nuclear receptor coactivator 1 (NCOA1) [Source:UniProtKB/TrEMBL;
Human Orthologue:
NCOA1
Human Description:
nuclear receptor coactivator 1 [Source:HGNC Symbol;Acc:7668]
Mouse Orthologue:
Ncoa1
Mouse Description:
nuclear receptor coactivator 1 Gene [Source:MGI Symbol;Acc:MGI:1276523]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39296 Essential Splice Site Mutation detected in F1 DNA During 2017
sa23769 Nonsense Available for shipment Available now
sa43501 Nonsense Mutation detected in F1 DNA During 2017
sa17222 Nonsense Available for shipment Available now
sa12342 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39296
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045948 Essential Splice Site 322 1367 8 27
ENSDART00000130513 Essential Splice Site 318 738 8 10
ENSDART00000147515   None 466 None 7
Genomic Location (Zv9):
Chromosome 20 (position 36793921)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36866434
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTTTATATTTTTGTGGAATAAGGAGCTGAAATTATGTTTGCTTTCCC[A/T]GTGATGACCCACGGCATGGCCATCAGTCCTCTCTACCATTTCACACTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045948 Nonsense 440 1367 9 27
ENSDART00000130513 Nonsense 436 738 9 10
ENSDART00000147515   None 466 None 7
Genomic Location (Zv9):
Chromosome 20 (position 36798236)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36870749
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCACTCCACCAGGCTACCTGACGCCCAGCCGCGTCGGGCCGTCACAG[C/T]AGGTCAGCAGCCCCTCTCCACTAGGCAGCCCTCTTACAGCAACCCCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43501
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045948 Nonsense 756 1367 14 27
ENSDART00000130513   None 738 None 10
ENSDART00000147515   None 466 None 7
Genomic Location (Zv9):
Chromosome 20 (position 36801862)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36874375
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTATTCCTCACTTCTTTTTATAGCATTCCCTGATGGAGAAAACCTCT[C/A]AAGTCAGACCTCTTTTGACTTTTGTGACCCATCCACACCAAACCAGGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17222
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045948 Nonsense 856 1367 16 27
ENSDART00000130513   None 738 None 10
ENSDART00000147515 Nonsense 6 466 1 7
Genomic Location (Zv9):
Chromosome 20 (position 36808037)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36880550
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCATCTCTGTCATTTGTGTTTKTCTCTGAGCAGGCAKTGTGTCCCGTG[T/A]CCGCTGGATGAGATGCTRTGTCCTCCCACCACCCCAGAGGGAYGAAACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045948 Essential Splice Site 1161 1367 None 27
ENSDART00000130513   None 738 None 10
ENSDART00000147515 Essential Splice Site 291 466 None 7
Genomic Location (Zv9):
Chromosome 20 (position 36812009)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36884522
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGAACACTCCTGTTCAACAGGGGCTTTTCCAGCAATTTGGGGGGTCTGG[T/G]ATGTGTCATTTGTATGTTTTATTTATTTTTTAAAAGAGAGCAACCMTTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link