mfap1

Ensembl ID:
ENSDARG00000018241
ZFIN ID:
ZDB-GENE-040426-1075
Description:
microfibrillar-associated protein 1 [Source:RefSeq peptide;Acc:NP_957311]
Human Orthologue:
MFAP1
Human Description:
microfibrillar-associated protein 1 [Source:HGNC Symbol;Acc:7032]
Mouse Orthologues:
Mfap1a, Mfap1b
Mouse Descriptions:
microfibrillar-associated protein 1A Gene [Source:MGI Symbol;Acc:MGI:1914782]
microfibrillar-associated protein 1B Gene [Source:MGI Symbol;Acc:MGI:3694697]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa21062 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21062
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028105 Nonsense 275 437 5 8
Genomic Location:
Chromosome 7 (position 51861437)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCTCTTGAGGCTCTGGACACAGATGGAGAAAACGAGGAAGAGGAGTA[C/A]GAAGCCTGGAAAGTCCGAGAACTGAAGCGTATTAAGAGGGACCGAGAATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6mw127qn