nck2a

Ensembl ID:
ENSDARG00000018206
ZFIN ID:
ZDB-GENE-040426-686
Description:
NCK adaptor protein 2a [Source:RefSeq peptide;Acc:NP_957291]
Mouse Orthologue:
Nck2
Mouse Description:
non-catalytic region of tyrosine kinase adaptor protein 2 Gene [Source:MGI Symbol;Acc:MGI:1306821]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa25415 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa25415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102672 Nonsense 199 403 3 4
Genomic Location (Zv9):
Chromosome 9 (position 6440830)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 6422026
KASP Assay ID:
554-7611.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGGGGTGTTCGGGGACACCGTGGGGGGGTTCCGGTCGTTGAAGGTGGGG[C/T]AAGGTTCAGCAATGGCCAACGGCCGGCCGGGGGGCTCTGGGAGCTCCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link