ubr5

Ensembl ID:
ENSDARG00000018192
ZFIN ID:
ZDB-GENE-030131-6559
Description:
E3 ubiquitin-protein ligase UBR5 [Source:RefSeq peptide;Acc:NP_001157866]
Human Orthologue:
UBR5
Human Description:
ubiquitin protein ligase E3 component n-recognin 5 [Source:HGNC Symbol;Acc:16806]
Mouse Orthologue:
Ubr5
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 5 Gene [Source:MGI Symbol;Acc:MGI:1918040]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17638 Essential Splice Site Available for shipment Available now
sa22959 Essential Splice Site Available for shipment Available now
sa36265 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22958 Nonsense Available for shipment Available now
sa22957 Nonsense Available for shipment Available now
sa36264 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa17638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Essential Splice Site 1533 2795 36 59
ENSDART00000111869   None 139 None 5
ENSDART00000128437 Essential Splice Site 1554 2816 35 58
ENSDART00000134444 Essential Splice Site 1560 2822 35 58
ENSDART00000141985   None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56191242)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52699742
KASP Assay ID:
2261-0376.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRAAATGATTTRGTGTGCATCTGAATCTGAGTKGAAATGTTTTCTTTT[A/C]GCTCCAGTCAGTCTGCCTCTTCATACATCATCAGGAACCCGCAGCCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22959
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Essential Splice Site 1574 2795 36 59
ENSDART00000111869   None 139 None 5
ENSDART00000128437 Essential Splice Site 1595 2816 35 58
ENSDART00000134444 Essential Splice Site 1601 2822 35 58
ENSDART00000141985   None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56191115)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52699615
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACGGGACGAGGAGCAGGATGATATCGTGTCTGCTGACGTAGAAGAGG[T/C]ATTAACAACTATTTCAACACTTTAAAGAACCATTCATGATATTAGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36265
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Essential Splice Site 1656 2795 39 59
ENSDART00000111869   None 139 None 5
ENSDART00000128437 Essential Splice Site 1677 2816 38 58
ENSDART00000134444 Essential Splice Site 1683 2822 38 58
ENSDART00000141985   None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56184366)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52692866
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGCTAATAGTTCTGACTTCAACTGTATATTTTCTACCTCTTTTCTGAA[G/T]GTGCCAGCAGTGTTCCTGCTTTCTTCTCCGAGGACGACTCCCAGTCGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22958
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Nonsense 1683 2795 39 59
ENSDART00000111869   None 139 None 5
ENSDART00000128437 Nonsense 1704 2816 38 58
ENSDART00000134444 Nonsense 1710 2822 38 58
ENSDART00000141985   None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56184285)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52692785
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGACTCCCAGTCGAATGACTCCAGCGACTCGGACAGCAGCAGCAGC[C/T]AGAGTGACGATGTGGATCAGGAGACGTTTCTGCTGGACGAGCCTCTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Nonsense 2079 2795 45 59
ENSDART00000111869   None 139 None 5
ENSDART00000128437 Nonsense 2100 2816 44 58
ENSDART00000134444 Nonsense 2106 2822 44 58
ENSDART00000141985   None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56173856)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52682356
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAATGCCAGAAAGGAGGATTTGTTTGGACGGCCTAGTCAAGGTCTATA[T/A]TCGTCCTCATATATGGCCAGTAAAGGCCTCACCGATCTGACTGTGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36264
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Nonsense 2503 2795 53 59
ENSDART00000111869   None 139 None 5
ENSDART00000128437 Nonsense 2524 2816 52 58
ENSDART00000134444 Nonsense 2530 2822 52 58
ENSDART00000141985   None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 56159696)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 52668196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGAGCTGGATGACCCTGATGATGGGGATGATAACGCTCCTCTGTTTTAC[C/T]AGCCTGGAAAGAGGGGTTTCTACTCACCACGTCCCGGCAAGAACACTGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link