ubr5

Ensembl ID:
ENSDARG00000018192
ZFIN ID:
ZDB-GENE-030131-6559
Description:
E3 ubiquitin-protein ligase UBR5 [Source:RefSeq peptide;Acc:NP_001157866]
Human Orthologue:
UBR5
Human Description:
ubiquitin protein ligase E3 component n-recognin 5 [Source:HGNC Symbol;Acc:16806]
Mouse Orthologue:
Ubr5
Mouse Description:
ubiquitin protein ligase E3 component n-recognin 5 Gene [Source:MGI Symbol;Acc:MGI:1918040]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17638 Essential Splice Site Available for shipment Available now
sa22959 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22958 Nonsense Mutation detected in F1 DNA During 2014
sa22957 Nonsense Available for shipment Available now
sa4685 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17638
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Essential Splice Site 1533 2795 36 59
ENSDART00000111869 None None 139 None 5
ENSDART00000128437 Essential Splice Site 1554 2816 35 58
ENSDART00000134444 Essential Splice Site 1560 2822 35 58
ENSDART00000141985 None None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 56191242)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACRAAATGATTTRGTGTGCATCTGAATCTGAGTKGAAATGTTTTCTTTT[A/C]GCTCCAGTCAGTCTGCCTCTTCATACATCATCAGGAACCCGCAGCCCCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22959
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Essential Splice Site 1574 2795 36 59
ENSDART00000111869 None None 139 None 5
ENSDART00000128437 Essential Splice Site 1595 2816 35 58
ENSDART00000134444 Essential Splice Site 1601 2822 35 58
ENSDART00000141985 None None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 56191115)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGACGGGACGAGGAGCAGGATGATATCGTGTCTGCTGACGTAGAAGAGG[T/C]ATTAACAACTATTTCAACACTTTAAAGAACCATTCATGATATTAGACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22958
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Nonsense 1683 2795 39 59
ENSDART00000111869 None None 139 None 5
ENSDART00000128437 Nonsense 1704 2816 38 58
ENSDART00000134444 Nonsense 1710 2822 38 58
ENSDART00000141985 None None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 56184285)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGACGACTCCCAGTCGAATGACTCCAGCGACTCGGACAGCAGCAGCAGC[C/T]AGAGTGACGATGTGGATCAGGAGACGTTTCTGCTGGACGAGCCTCTTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Nonsense 2079 2795 45 59
ENSDART00000111869 None None 139 None 5
ENSDART00000128437 Nonsense 2100 2816 44 58
ENSDART00000134444 Nonsense 2106 2822 44 58
ENSDART00000141985 None None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 56173856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCAATGCCAGAAAGGAGGATTTGTTTGGACGGCCTAGTCAAGGTCTATA[T/A]TCGTCCTCATATATGGCCAGTAAAGGCCTCACCGATCTGACTGTGGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4685
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000035761 Nonsense 2715 2795 58 59
ENSDART00000111869 None None 139 None 5
ENSDART00000128437 Nonsense 2736 2816 57 58
ENSDART00000134444 Nonsense 2742 2822 57 58
ENSDART00000141985 None None 248 None 5

The following transcripts of ENSDARG00000018192 do not overlap with this mutation:

Genomic Location:
Chromosome 16 (position 56150391)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAATGCAGAGAAGCTGCTGCAGTTCAAGCGCTGGTTTTGGTCCATCGTT[G/T]AGAAGATGAGCATGACGGAAAGGCAGGACCTGGTGAGACACTACTGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/cqxp78a4