dnajc28

Ensembl ID:
ENSDARG00000018181
ZFIN ID:
ZDB-GENE-050417-130
Description:
dnaJ homolog subfamily C member 28 [Source:RefSeq peptide;Acc:NP_001017648]
Human Orthologue:
DNAJC28
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 28 [Source:HGNC Symbol;Acc:1297]
Mouse Orthologue:
Dnajc28
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 28 Gene [Source:MGI Symbol;Acc:MGI:2181053]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14381 Nonsense Available for shipment Available now
sa34698 Nonsense Mutation detected in F1 DNA During 2017
sa41476 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14381
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013432 Nonsense 108 376 2 2
Genomic Location (Zv9):
Chromosome 9 (position 36926540)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36064429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCTGTGCTCGCCCACCTCGCTCGGCAGAAGTCAGCTTCACAGTACACC[C/T]AATCTATGGAGGAAGACGAGGACGAGAAAGTGAAAGGTAATGCTCCTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013432 Nonsense 212 376 2 2
Genomic Location (Zv9):
Chromosome 9 (position 36926228)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36064117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAGGCTGGTTGAGGATCTCATCCAGGAATCAATGGCTCGTGGAGACTTT[C/T]AGAACCTCAGCGGCACTGGTAAACCGCTCAATAAGTTTGATTACAACCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013432 Nonsense 365 376 2 2
Genomic Location (Zv9):
Chromosome 9 (position 36925769)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 36063658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAATGAAAAGGAGCAGATGGAGACGACGGAAATGTCTCAGCACACCAGA[C/T]AAGGACTCATCGCATGGATGCAGAATCTGCTGAAATGAGGTTGTGTGTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link