pgm2

Ensembl ID:
ENSDARG00000018178
ZFIN ID:
ZDB-GENE-040426-2218
Description:
phosphoglucomutase-2 [Source:RefSeq peptide;Acc:NP_998051]
Human Orthologue:
PGM2
Human Description:
phosphoglucomutase 2 [Source:HGNC Symbol;Acc:8906]
Mouse Orthologue:
Pgm1
Mouse Description:
phosphoglucomutase 1 Gene [Source:MGI Symbol;Acc:MGI:97564]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13033 Essential Splice Site Available for shipment Available now
sa25557 Nonsense Mutation detected in F1 DNA During 2017
sa30800 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39589 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13033
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020970 Essential Splice Site 173 611 4 13
Genomic Location (Zv9):
Chromosome 1 (position 17533672)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18098840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATCATGGTAACAGCCTCCCATAATCCCAAACAAGATAACGGATACAAG[G/T]TAGCATCCAACCCTCAMTTAAATCTGATGTTTAATWTGGAAGACTAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25557
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020970 Nonsense 196 611 5 13
Genomic Location (Zv9):
Chromosome 1 (position 17533500)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18098668
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGCTCAGATCATTCCTCCTCATGATAAGGGCATCGCTGCAGCTATAGAA[C/T]AAAACCTTGAGCCCTGGCCTGAATCCTGGGACACAGATGAGGGTCTTCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30800
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020970 Essential Splice Site 334 611 8 13
ENSDART00000020970 Essential Splice Site 334 611 8 13
Genomic Location (Zv9):
Chromosome 1 (position 17530424)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18095592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCTTTTCATTCAGCATGTCAGATTATAAACGACTGTAATTCTCTGT[A/T]GTGGGAAGTGGAGAGTTTTCTCTGGGAATGAATTAGGTGCTTTACTCGGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39589
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020970 Essential Splice Site 334 611 8 13
ENSDART00000020970 Essential Splice Site 334 611 8 13
Genomic Location (Zv9):
Chromosome 1 (position 17530424)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18095592
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGCTTTTCATTCAGCATGTCAGATTATAAACGACTGTAATTCTCTGT[A/T]GTGGGAAGTGGAGAGTTTTCTCTGGGAATGAATTAGGTGCTTTACTCGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link