gnai2l

Ensembl ID:
ENSDARG00000018174
ZFIN ID:
ZDB-GENE-030131-8365
Description:
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2, like [Sour
Human Orthologue:
GNAI2
Human Description:
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 [Source:HGNC
Mouse Orthologue:
Gnai2
Mouse Description:
guanine nucleotide binding protein (G protein), alpha inhibiting 2 Gene [Source:MGI Symbol;Acc:MGI:9

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10353 Nonsense Available for shipment Available now
sa35131 Nonsense Mutation detected in F1 DNA During 2016
sa12394 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034039 Nonsense 100 338 4 9
ENSDART00000128070 Nonsense 117 355 4 9
Genomic Location (Zv9):
Chromosome 11 (position 35657505)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34757756
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGGATGATGCCCGTCAGTTGTTTGCCCTGTCTGGGACAGCAGAAGAG[C/T]AGGGTATCCTTCCAGACGAGCTGGCCAATGTCATCTGCAGACTGTGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35131
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034039 Nonsense 226 338 7 9
ENSDART00000128070 Nonsense 243 355 7 9
Genomic Location (Zv9):
Chromosome 11 (position 35642689)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34772572
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATAATCCTTCAGAAATTATTCTAACATCTCTTCATTTCATTACAGAAT[C/T]GAATGCACGAGAGCATGAAGCTCTTCGACAGCATCTGCAACAACAAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034039 Essential Splice Site None 338 8 9
ENSDART00000128070 Essential Splice Site None 355 8 9
Genomic Location (Zv9):
Chromosome 11 (position 35639014)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 34776247
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGACTGTGGGCTCTTCTAGACCWCACGAGYGAAAGGATGAGATGAGG[T/G]AACTAGTGATGCTGAAATATGWTGCACGARTTGAYCAATTTCAKTRTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link