gnai2l

Ensembl ID:
ENSDARG00000018174
ZFIN ID:
ZDB-GENE-030131-8365
Description:
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2, like [Sour
Human Orthologue:
GNAI2
Human Description:
guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 2 [Source:HGNC
Mouse Orthologue:
Gnai2
Mouse Description:
guanine nucleotide binding protein (G protein), alpha inhibiting 2 Gene [Source:MGI Symbol;Acc:MGI:9

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10353 Nonsense Available for shipment Available now
sa12394 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10353
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034039 Nonsense 100 338 4 9
ENSDART00000128070 Nonsense 117 355 4 9
Genomic Location:
Chromosome 11 (position 35657505)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTAGGATGATGCCCGTCAGTTGTTTGCCCTGTCTGGGACAGCAGAAGAG[C/T]AGGGTATCCTTCCAGACGAGCTGGCCAATGTCATCTGCAGACTGTGGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12394
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034039 Essential Splice Site None 338 8 9
ENSDART00000128070 Essential Splice Site None 355 8 9
Genomic Location:
Chromosome 11 (position 35639014)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGGACTGTGGGCTCTTCTAGACCWCACGAGYGAAAGGATGAGATGAGG[T/G]AACTAGTGATGCTGAAATATGWTGCACGARTTGAYCAATTTCAKTRTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6f42hk5f