depdc1a

Ensembl ID:
ENSDARG00000018165
ZFIN ID:
ZDB-GENE-030131-9827
Description:
DEP domain-containing protein 1A [Source:UniProtKB/Swiss-Prot;Acc:Q803Q4]
Human Orthologue:
DEPDC1
Human Description:
DEP domain containing 1 [Source:HGNC Symbol;Acc:22949]
Mouse Orthologue:
Depdc1a
Mouse Description:
DEP domain containing 1a Gene [Source:MGI Symbol;Acc:MGI:1923381]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21241 Nonsense Available for shipment Available now
sa34360 Nonsense Mutation detected in F1 DNA During 2017
sa2458 Essential Splice Site F2 line generated During 2017
sa13687 Nonsense Available for shipment Available now
sa41162 Nonsense Mutation detected in F1 DNA During 2017
sa16447 Essential Splice Site Available for shipment Available now
sa18914 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa21241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Nonsense 57 800 2 12
Genomic Location (Zv9):
Chromosome 8 (position 17243870)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16688758
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACGAACTGCTTCACCGCATCCACCGCTGTGGACTGGTTACATGAACTCT[T/A]GAAAAACAACAGCAATTTTGGACCAGATGTCACCCGACAGCAGACAGTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34360
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Nonsense 191 800 5 12
Genomic Location (Zv9):
Chromosome 8 (position 17241566)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16686454
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTAAATGTCATATTGTTGTTGAATTTGATTGTCATTTGAATGTTCAGTT[T/A]GCAGAAGTTGGTGGGATCTGCTTCTCTGGAAGGCGTTTTGGATCCAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2458
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Essential Splice Site 296 800 7 12
Genomic Location (Zv9):
Chromosome 8 (position 17240757)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16685645
KASP Assay ID:
554-3331.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCACTGCTCACTTATCAGTATTACGAACTCTTTGTCAACATCCTGGG[T/A]ATGTATGAAACATGTTTTGGATTTTGCATGTCTGTSATCAGGTTATGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13687
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Nonsense 344 800 8 12
Genomic Location (Zv9):
Chromosome 8 (position 17238403)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16683291
KASP Assay ID:
2260-0354.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTGAACCCAGCCAACCTGTTCAGGTCCACCGAATGYCTWCTGCTCAGCY[T/G]AATAAGAAARGAGGCCATCGATGAAGCCGATTCGCCCATGAAGGAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Nonsense 535 800 8 12
Genomic Location (Zv9):
Chromosome 8 (position 17237830)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16682718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGACTCCACATCCAGTGTTGGCTTCAGAGGTCTCGGTTTGTCCAGTT[T/A]GCATGGAAGTTGCGTGGATGTTAGAACAGGTCCAAGCTTTAGCAGACGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16447
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Essential Splice Site 635 800 9 12
ENSDART00000049676 Essential Splice Site 635 800 9 12
Genomic Location (Zv9):
Chromosome 8 (position 17235304)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16680192
KASP Assay ID:
2260-0353.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAACGTGGACATGCCACGGTTACAYGACGTCATCGGAACACGCACTCTGG[T/C]CAGGAGKAGTTCAATRGATGCAGCTGATTTGTTATATTTAWAACCATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18914
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049676 Essential Splice Site 635 800 9 12
ENSDART00000049676 Essential Splice Site 635 800 9 12
Genomic Location (Zv9):
Chromosome 8 (position 17235304)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 16680192
KASP Assay ID:
2260-0353.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAACGTGGACATGCCACGGTTACACGACGTCATCGGAACACGCACTCTGG[T/C]CAGGAGGAGTTCAATGGATGCAGCTGATTTGTTATATTTATAACCATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link