si:ch211-254e15.1

Ensembl ID:
ENSDARG00000018162
ZFIN ID:
ZDB-GENE-060503-507
Description:
hypothetical protein LOC100034581 [Source:RefSeq peptide;Acc:NP_001137526]
Human Orthologue:
CTNNAL1
Human Description:
catenin (cadherin-associated protein), alpha-like 1 [Source:HGNC Symbol;Acc:2512]
Mouse Orthologue:
Ctnnal1
Mouse Description:
catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI Symbol;Acc:MGI:1859649]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43314 Nonsense Mutation detected in F1 DNA During 2017
sa36875 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36874 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa43314
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016057 Nonsense 498 754 11 19
Genomic Location (Zv9):
Chromosome 19 (position 36314296)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35178816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCAAAGAGAACCTGGATGTATTTTGTGAGGCCTGGGAGTCCCAGCTCTG[C/A]GACATGGCGATCCTATTGAAGGAGATTAATGATGTGTTTGAGGGCCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36875
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016057 Essential Splice Site 528 754 12 19
ENSDART00000016057 Essential Splice Site 528 754 12 19
Genomic Location (Zv9):
Chromosome 19 (position 36311583)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35176103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTAGGTGATAAGAAAACATATCTGTCTTTACCAAGGCCAGGGG[T/C]GAGTGTGATGAGGAACTATGATTTTATTACAAATTTGATTTACCATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36874
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016057 Essential Splice Site 528 754 12 19
ENSDART00000016057 Essential Splice Site 528 754 12 19
Genomic Location (Zv9):
Chromosome 19 (position 36311583)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 35176103
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTTTTTTAGGTGATAAGAAAACATATCTGTCTTTACCAAGGCCAGGGG[T/C]GAGTGTGATGAGGAACTATGATTTTATTACAAATTTGATTTACCATATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link