psmd3

Ensembl ID:
ENSDARG00000018124
ZFIN ID:
ZDB-GENE-040426-1444
Description:
26S proteasome non-ATPase regulatory subunit 3 [Source:RefSeq peptide;Acc:NP_956866]
Human Orthologue:
PSMD3
Human Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 [Source:HGNC Symbol;Acc:9560]
Mouse Orthologue:
Psmd3
Mouse Description:
proteasome (prosome, macropain) 26S subunit, non-ATPase, 3 Gene [Source:MGI Symbol;Acc:MGI:98858]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14257 Essential Splice Site Available for shipment Available now
sa36924 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa14257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027158 Essential Splice Site 43 503 1 12
Genomic Location (Zv9):
Chromosome 19 (position 49784478)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48389213
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAGGAGCAGCGCGGGGCCCGGGAACTGGACCAGACCACTCTGGACGG[T/C]CAGAACRCTCTAYAATACAGTATATTACTGACCCATAACACACAGGGGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36924
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027158 Nonsense 182 503 4 12
Genomic Location (Zv9):
Chromosome 19 (position 49780891)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 48392800
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGAACCGCCGTGCGCTGGATCTGGTGGCCGCTAAGTGCTACTATTA[T/A]CACTCACGTGTGTATGAGTTCCTGAACCAGCTGGACGTGGTGCGCAGGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link