jhdm1da

Ensembl ID:
ENSDARG00000018111
ZFIN ID:
ZDB-GENE-030131-9829
Description:
Lysine-specific demethylase 7A [Source:UniProtKB/Swiss-Prot;Acc:Q5RHD1]
Human Orthologue:
JHDM1D
Human Description:
jumonji C domain containing histone demethylase 1 homolog D (S. cerevisiae) [Source:HGNC Symbol;Acc:
Mouse Orthologue:
Jhdm1d
Mouse Description:
jumonji C domain-containing histone demethylase 1 homolog D (S. cerevisiae) Gene [Source:MGI Symbol;

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15622 Essential Splice Site Available for shipment Available now
sa8925 Nonsense Mutation detected in F1 DNA During 2016
sa9752 Nonsense Available for shipment Available now
sa33465 Nonsense Mutation detected in F1 DNA During 2016
sa10471 Nonsense Available for shipment Available now
sa10721 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa15622
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002851 Essential Splice Site 154 613 None 14
ENSDART00000113426 Essential Splice Site 154 846 None 21
ENSDART00000123801   154 188 4 4
ENSDART00000130409 Essential Splice Site 154 875 None 19
Genomic Location (Zv9):
Chromosome 4 (position 21441677)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22785012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAACTGCCCCCYCCATCAKTCTCTGTCAGTGATGTGGAGCATWACGTTGG[T/G]AAGATTTWAGAGTGTGTGTTTGTGTGCRTTGAATTTAMTGTCTACCTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002851   None 613 None 14
ENSDART00000113426   None 846 None 21
ENSDART00000123801 Nonsense 157 188 4 4
ENSDART00000130409   None 875 None 19
Genomic Location (Zv9):
Chromosome 4 (position 21441669)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22785004
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCYCCATCAKTCTCTGTCAGTGATGTGGAGCATTACGTTGGTAAGATTT[T/A]AGAGTGTGTGTTTGTGTGCATTGAATTTAMTGTCTACCTGATGACTCCCW
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9752
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002851   None 613 None 14
ENSDART00000113426   None 846 None 21
ENSDART00000123801 Nonsense 183 188 4 4
ENSDART00000130409   None 875 None 19
Genomic Location (Zv9):
Chromosome 4 (position 21441590)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22784925
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AMTGTCTACCTGATGACTCCCWKGAGAGTATTTGGGCTTTTGGGACACTA[C/A]AGYGATATTAGTATTTAAATCAATAACACATTGGAACTTGTACAAAATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33465
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002851 Nonsense 237 613 6 14
ENSDART00000113426 Nonsense 237 846 6 21
ENSDART00000123801   None 188 None 4
ENSDART00000130409 Nonsense 237 875 6 19
Genomic Location (Zv9):
Chromosome 4 (position 21436504)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22779839
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGGCCCGATGACTCGTTCTTCCCCAAACCGTTCGTGCAGAAGTATTG[T/A]CTTATGGGAATGAAAAACAGCTACACAGATTTCCACATCGACTTTGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10471
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002851 Nonsense 337 613 8 14
ENSDART00000113426 Nonsense 337 846 8 21
ENSDART00000123801   None 188 None 4
ENSDART00000130409 Nonsense 337 875 8 19
Genomic Location (Zv9):
Chromosome 4 (position 21432285)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22775620
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATGCTGTTCTCACTTCTCAGGACTCGATGGCGTTTGGAGGAAACTTCT[T/A]GCATAACTTAAACATAGACATGCAGCTCAGGTGCGATCCTTCAGTCGSGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10721
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002851 Essential Splice Site 531 613 None 14
ENSDART00000113426 Essential Splice Site 508 846 None 21
ENSDART00000123801   None 188 None 4
ENSDART00000130409 Essential Splice Site 531 875 None 19
Genomic Location (Zv9):
Chromosome 4 (position 21430176)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22773511
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACACTGGAGGTGTTGAAGAGACTRGAGGTTGGCCAGCTGAAGGAGG[T/C]CAGTGCTGTGGACACTYTATTCTTTATCAMGTTTTTTTTTNNNTGTTTGTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link