rab3da

Ensembl ID:
ENSDARG00000018107
ZFIN ID:
ZDB-GENE-080722-14
Description:
RAB3D, member RAS oncogene family, a [Source:RefSeq peptide;Acc:NP_001139069]
Human Orthologue:
RAB3D
Human Description:
RAB3D, member RAS oncogene family [Source:HGNC Symbol;Acc:9779]
Mouse Orthologue:
Rab3d
Mouse Description:
RAB3D, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:97844]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39698 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023757 Nonsense 95 223 2 4
ENSDART00000143805 Nonsense 95 168 3 4
ENSDART00000146372 Nonsense 95 223 3 5
Genomic Location (Zv9):
Chromosome 1 (position 52678417)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 51549366
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGACACAGCGGGACAGGAGAGGTACCGAACCATAACCACAGCTTACTA[C/A]AGAGGGGCCATGGGATTTCTGCTCATGTATGACATCACTAACCAAGATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link