eif2b3

Ensembl ID:
ENSDARG00000018106
ZFIN ID:
ZDB-GENE-040426-1039
Description:
translation initiation factor eIF-2B subunit gamma [Source:RefSeq peptide;Acc:NP_957368]
Human Orthologue:
EIF2B3
Human Description:
eukaryotic translation initiation factor 2B, subunit 3 gamma, 58kDa [Source:HGNC Symbol;Acc:3259]
Mouse Orthologue:
Eif2b3
Mouse Description:
eukaryotic translation initiation factor 2B, subunit 3 Gene [Source:MGI Symbol;Acc:MGI:1313286]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32957 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa32957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020786 Nonsense 21 453 2 12
ENSDART00000132274 Nonsense 21 170 3 6
Genomic Location (Zv9):
Chromosome 2 (position 33789321)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 34088228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGTGCTGATGGCAGCCGGTGGAGGCTCCAGGATGATGGATCTCACCTA[T/G]AACACCCCCAAACCTCTGCTTCCTGTGGGCAACAAACCCCTCATCTGGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link