si:dkey-201i6.4

Ensembl ID:
ENSDARG00000018096
ZFIN ID:
ZDB-GENE-100922-72
Human Orthologue:
SCAP
Human Description:
SREBF chaperone [Source:HGNC Symbol;Acc:30634]
Mouse Orthologue:
Scap
Mouse Description:
SREBF chaperone Gene [Source:MGI Symbol;Acc:MGI:2135958]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa484 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa484
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015566 Essential Splice Site 1075 1252 20 23
ENSDART00000141130   None 1245 None 23
Genomic Location (Zv9):
Chromosome 16 (position 43766452)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 41150845
KASP Assay ID:
554-0335.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATATATATATATATTTATTACAATAGCTTGATAATCTGAAAAGCAAA[G/A]GAAGCAACACTTATATAATAAAGTTTACCTAAAATATTAGGTGCTAACGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link