rdh12

Ensembl ID:
ENSDARG00000018069
ZFIN ID:
ZDB-GENE-040718-9
Description:
retinol dehydrogenase 12 [Source:RefSeq peptide;Acc:NP_001002325]
Human Orthologues:
RDH11, RDH12
Human Descriptions:
retinol dehydrogenase 11 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:17964]
retinol dehydrogenase 12 (all-trans/9-cis/11-cis) [Source:HGNC Symbol;Acc:19977]
Mouse Orthologues:
Rdh11, Rdh12
Mouse Descriptions:
retinol dehydrogenase 11 Gene [Source:MGI Symbol;Acc:MGI:102581]
retinol dehydrogenase 12 Gene [Source:MGI Symbol;Acc:MGI:1925224]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42241 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000045484 Nonsense 216 319 5 7
ENSDART00000137315 Nonsense 217 320 5 7
Genomic Location (Zv9):
Chromosome 13 (position 33286048)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 32931996
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGGACTTGCCTACTGCCAGAGCAAACTCGCTAACGTGCTTTTCACTCGT[G/T]AGCTGGCGCGCAGACTCCAGGGTAACTCAAATAATGATTCGACATGAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link