ntm

Ensembl ID:
ENSDARG00000018065
ZFIN ID:
ZDB-GENE-060421-6020
Description:
neurotrimin isoform 1 [Source:RefSeq peptide;Acc:NP_001003852]
Human Orthologues:
IGLON5, LSAMP, NEGR1, NTM, OPCML
Human Descriptions:
IgLON family member 5 [Source:HGNC Symbol;Acc:34550]
limbic system-associated membrane protein [Source:HGNC Symbol;Acc:6705]
neuronal growth regulator 1 [Source:HGNC Symbol;Acc:17302]
neurotrimin [Source:HGNC Symbol;Acc:17941]
opioid binding protein/cell adhesion molecule-like [Source:HGNC Symbol;Acc:8143]
Mouse Orthologues:
Iglon5, Lsamp, Negr1, Ntm, Opcml
Mouse Descriptions:
IgLON family member 5 Gene [Source:MGI Symbol;Acc:MGI:2686277]
limbic system-associated membrane protein Gene [Source:MGI Symbol;Acc:MGI:1261760]
neuronal growth regulator 1 Gene [Source:MGI Symbol;Acc:MGI:2444846]
neurotrimin Gene [Source:MGI Symbol;Acc:MGI:2446259]
opioid binding protein/cell adhesion molecule-like Gene [Source:MGI Symbol;Acc:MGI:97397]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa27629 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa27629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011317 Nonsense 67 305 3 7
ENSDART00000064097 Nonsense 50 358 2 9
ENSDART00000099964 Nonsense 67 317 3 8
ENSDART00000113912 Nonsense 31 301 2 7

The following transcripts of ENSDARG00000018065 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 31510285)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 30611634
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGTTGCTCGCAAGGGGACTTTGTGACACACACAGCATGGCTGAACAGAT[C/A]GAGTATACTCTACGCCGGAGAGGATAAGTGGTCTGTGGACCCGCGGGTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link