pik3r2

Ensembl ID:
ENSDARG00000018060
ZFIN ID:
ZDB-GENE-040309-1
Description:
phosphatidylinositol 3-kinase regulatory subunit beta [Source:RefSeq peptide;Acc:NP_997987]
Human Orthologue:
PIK3R2
Human Description:
phosphoinositide-3-kinase, regulatory subunit 2 (beta) [Source:HGNC Symbol;Acc:8980]
Mouse Orthologue:
Pik3r2
Mouse Description:
phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 2 (p85 beta) Gene [Source:MGI Symbol;

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12841 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12841
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000056822 Essential Splice Site 371 724 8 15
ENSDART00000147207 Essential Splice Site 263 616 7 14
Genomic Location (Zv9):
Chromosome 2 (position 24507046)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25081823
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCGGGACGCTTCAAGCAAAGTGCACGGAGAGTACACTTTGACCCTCAGG[T/C]GAGCACTGTGTCAGGTCAAATCKCATTTGATGTCTAATATGCGACGAATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link