scn8ab

Ensembl ID:
ENSDARG00000018032
ZFIN ID:
ZDB-GENE-060906-2
Description:
sodium channel, voltage-gated, type VIII, alpha b [Source:RefSeq peptide;Acc:NP_001038648]
Human Orthologue:
SCN8A
Human Description:
sodium channel, voltage gated, type VIII, alpha subunit [Source:HGNC Symbol;Acc:10596]
Mouse Orthologue:
Scn8a
Mouse Description:
sodium channel, voltage-gated, type VIII, alpha Gene [Source:MGI Symbol;Acc:MGI:103169]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2298 Nonsense Available for shipment Available now
sa8756 Nonsense Mutation detected in F1 DNA During 2017
sa33913 Nonsense Mutation detected in F1 DNA During 2017
sa33912 Nonsense Available for shipment Available now
sa20765 Nonsense Available for shipment Available now
sa9145 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa2298
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 198 1958 4 26
Genomic Location (Zv9):
Chromosome 6 (position 39389104)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39460704
KASP Assay ID:
554-2723.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGAGGTTTCTGTATAGACGACTTCACCTTCCTCAGAGACCCCTGGAACTG[G/A]CTGGATTTCATGGTYATCTCTATGGCGTAAGTATGATAATGTYCTGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8756
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1012 1958 16 26
Genomic Location (Zv9):
Chromosome 6 (position 39349094)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39420694
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CYGAAGAAGAAACCTCTGGAAGATGAAGACAAACCGCTYGATGACATRTA[T/A]GACAAAAAACTGAACTTAATGGGCAACCACACCGGYGTGGAAATCAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33913
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1174 1958 18 26
Genomic Location (Zv9):
Chromosome 6 (position 39340703)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39412303
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTGGTGGTTTCTGAGGAAAACTTGCTACCTCATTGTTGAGCACAACTG[G/A]TTTGAGACGCTCATCATTTTTATGATTCTTCTCAGCTCTGGAGCTTTGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33912
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1310 1958 21 26
Genomic Location (Zv9):
Chromosome 6 (position 39329028)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39400628
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTTTGGTGGGTGCCATTCCCTCCATCATGAATGTGCTGTTGGTGTGTT[T/A]GATCTTTTGGCTGATCTTCAGTATTATGGGTGTCAACCTGTTTGCTGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1554 1958 25 26
Genomic Location (Zv9):
Chromosome 6 (position 39325891)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39397491
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCCTTCACTGGCGAGTTCGTCCTGAAACTCTTTGCGCTGCGACACTA[T/G]TATTTCACCAATGGCTGGAATGTCTTTGACTGCGTCGTTGTCATTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9145
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022761 Nonsense 1682 1958 26 26
Genomic Location (Zv9):
Chromosome 6 (position 39324138)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39395738
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTGGCAACAGCATGATCTGTCTATTCATGATCACCACATCAGCTGGCT[G/A]GGATGGCCTGTTGGCTCCTATCTTGAACTATCCGCCTGACTGCGACCCTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link