GCNFA_DANRE

Ensembl ID:
ENSDARG00000018030
Description:
Nuclear receptor subfamily 6 group A member 1-A [Source:UniProtKB/Swiss-Prot;Acc:Q9PU65]
Human Orthologue:
NR6A1
Human Description:
nuclear receptor subfamily 6, group A, member 1 [Source:HGNC Symbol;Acc:7985]
Mouse Orthologue:
Nr6a1
Mouse Description:
nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1352459]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34517 Splice Site, Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34517
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006409 Splice Site, Nonsense 103 450 2 8
ENSDART00000100982 Splice Site, Nonsense 98 445 3 9
ENSDART00000130361 Splice Site, Nonsense 100 447 3 9
Genomic Location (Zv9):
Chromosome 8 (position 54786623)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 52918721
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGAGAAGATGGCATGCCGGGAGGAAGAAACAAAAGCATCGGCCCTGTA[C/T]AGGTATTACCCATAACCCCTCATTCAGCATCCCTGATCCTTGTCCATACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link