msh2

Ensembl ID:
ENSDARG00000018022
ZFIN ID:
ZDB-GENE-040426-2932
Description:
DNA mismatch repair protein Msh2 [Source:RefSeq peptide;Acc:NP_998689]
Human Orthologue:
MSH2
Human Description:
mutS homolog 2, colon cancer, nonpolyposis type 1 (E. coli) [Source:HGNC Symbol;Acc:7325]
Mouse Orthologue:
Msh2
Mouse Description:
mutS homolog 2 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:101816]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu1886 Essential Splice Site Confirmed mutation in F2 line Unknown
sa6253 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22101 Essential Splice Site Mutation detected in F1 DNA During 2014
sa11438 Nonsense Available for shipment Available now
sa24911 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu1886
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Unknown
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002465 Essential Splice Site 314 936 5 16
Genomic Location:
Chromosome 12 (position 26427255)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTACATGCGCCTGGATAATGCTGCTGTACAGGCTCTCAATCTCTTTCAG[G/A]TTAGTGCTCATTTAAAAACGAGAAATAGGCCATTTCTTCAGCTAAGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6253
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002465 Essential Splice Site 314 936 5 16
Genomic Location:
Chromosome 12 (position 26427254)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTACATGCGCCTGGATAATGCTGCTGTACAGGCTCTCAATCTCTTTCAGG[T/C]TAGTGCTCATTTAAAAACGAGAAATAGGCCATTTCTTCAGCYAAGGCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22101
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002465 Essential Splice Site 426 936 7 16
Genomic Location:
Chromosome 12 (position 26426117)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGTGGGGCAACTGCCCAATGTGGTGCTGGCACTGGAGAGATACAGTGG[T/C]AAGCAAAACAACAACTTTATCAATAATCGATAACATTAAGCCTGAGAATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002465 Nonsense 451 936 8 16
Genomic Location:
Chromosome 12 (position 26425110)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCATTCATCTCTCCACTAAACGACCTCATCTCAGACTTCTCCAAATTT[C/T]AGGAGATGATTGAAACCACACTKGACATGAACCAGGTCTGCTCTTGTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24911
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002465 Essential Splice Site 876 936 15 16
Genomic Location:
Chromosome 12 (position 26412924)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGGGAGGAAGCAGGACCCAAAGCCAAGAAACGCTGCATGGAGAAACAG[G/A]TGAGAGGTGTTATTGAAAGAAACTTGGCATTTGCTGTGCAGCTCATTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ayn8wfen