pepd

Ensembl ID:
ENSDARG00000018020
ZFIN ID:
ZDB-GENE-030131-9444
Description:
prolidase [Source:RefSeq peptide;Acc:NP_944594]
Human Orthologue:
PEPD
Human Description:
peptidase D [Source:HGNC Symbol;Acc:8840]
Mouse Orthologue:
Pepd
Mouse Description:
peptidase D Gene [Source:MGI Symbol;Acc:MGI:97542]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9779 Nonsense Available for shipment Available now
sa5906 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa9779
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004023 Nonsense 149 496 9 18
Genomic Location (Zv9):
Chromosome 18 (position 1162999)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 1710509
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAATAATGAGATGGTTTAACGTGTTTCTCTGTGTTTCYTCGTGTGTAG[C/T]GAGGGCWGAACACTGATAGYGGYAGCACCTGTCGTGAAGCCTCCTTTRAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004023 Essential Splice Site 209 496 11 18
Genomic Location (Zv9):
Chromosome 18 (position 1153959)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149820.1 234
KASP Assay ID:
554-3645.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAGTTCTGCGCTACACAAACCGCATTTCCAGCGAAGCCCATAAAGAGG[T/C]AAAAACACCACCGTCTGTCAATTCATTTCMCTGTTAATAAGCTATWCTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link