crtap

Ensembl ID:
ENSDARG00000018010
ZFIN ID:
ZDB-GENE-040426-2619
Description:
cartilage-associated protein [Source:RefSeq peptide;Acc:NP_001001406]
Human Orthologue:
CRTAP
Human Description:
cartilage associated protein [Source:HGNC Symbol;Acc:2379]
Mouse Orthologue:
Crtap
Mouse Description:
cartilage associated protein Gene [Source:MGI Symbol;Acc:MGI:1891221]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29258 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36907 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa29258
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010104 Essential Splice Site 153 396 1 7
Genomic Location (Zv9):
Chromosome 19 (position 44212399)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43040167
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTGATAAACGGGAGCCATACAAGTACCTGCAGTTCGCCTACTTCAAAG[T/C]GAGTAACGTAACGTTGCTGCTTTACTCACGTTTATTTAGTATACGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010104 Nonsense 221 396 3 7
Genomic Location (Zv9):
Chromosome 19 (position 44215129)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43042897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGTTCATTCGGGCCGTGCGAGCGTATAATGGAGATAATTTCCGAACGT[C/A]GGTGTCAGATATGGAGCTGGCACTGAGAGACTTTTTTAAGGTATACGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link