si:ch211-207c15.3

Ensembl ID:
ENSDARG00000018000
ZFIN ID:
ZDB-GENE-060503-870
Description:
upstream-binding protein 1 [Source:RefSeq peptide;Acc:NP_001108046]
Human Orthologue:
UBP1
Human Description:
upstream binding protein 1 (LBP-1a) [Source:HGNC Symbol;Acc:12507]
Mouse Orthologue:
Ubp1
Mouse Description:
upstream binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:104889]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39259 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39260 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa39259
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108775 Essential Splice Site 39 544 2 16
Genomic Location (Zv9):
Chromosome 19 (position 44420241)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43248009
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGTTCATCTCATAACCTCAGTTTCTCTGTGTGTCTGTCTCTGTTTCTCA[G/A]TGATGTGTTGGCTCTGCCCATCTTTAAGCAGGAAGATGTGAGCGTTCCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39260
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108775 Essential Splice Site 366 544 11 16
Genomic Location (Zv9):
Chromosome 19 (position 44434669)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 43262437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTATTCTAATTAGCATTTAAAAATTAAATGTGCACTTTTATTATACA[G/A]TCTCTCAGTCCTACGGCCTCCATACAGGACACACAGAAGTGGCTCCTTAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link