rtdr1

Ensembl ID:
ENSDARG00000017983
ZFIN ID:
ZDB-GENE-081104-375
Description:
Novel protein similar to vertebrate rhabdoid tumor deletion region gene 1 (RTDR1) [Source:UniProtKB/
Human Orthologue:
RTDR1
Human Description:
rhabdoid tumor deletion region gene 1 [Source:HGNC Symbol;Acc:13437]
Mouse Orthologue:
Rtdr1
Mouse Description:
rhabdoid tumor deletion region gene 1 Gene [Source:MGI Symbol;Acc:MGI:1918486]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1690 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1690
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026831 Nonsense 304 340 7 7
ENSDART00000113945 None None 225 None 6
Genomic Location:
Chromosome 8 (position 46973923)
KASP Assay ID:
554-1636.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGCTAAYGCCCTCCGTGCCCTTACAGTTCTGGCAGAAGTTCCCAGAGCC[C/T]GAGCACATCTGCGGCAGCATGTACCTCTGCTGAAGACCAGACTCACAGAT
Associated Phenotype:
Data not yet available

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bone mineral density: Genome-wide meta-analysis identifies 56 bone mineral density loci and reveals 14 loci associated with risk of fracture. (View Study)
  • Height: Many sequence variants affecting diversity of adult human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6sciluns