ptk6a

Ensembl ID:
ENSDARG00000017947
ZFIN ID:
ZDB-GENE-081105-117
Human Orthologue:
PTK6
Human Description:
PTK6 protein tyrosine kinase 6 [Source:HGNC Symbol;Acc:9617]
Mouse Orthologue:
Ptk6
Mouse Description:
PTK6 protein tyrosine kinase 6 Gene [Source:MGI Symbol;Acc:MGI:99683]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6099 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063047 Essential Splice Site 329 563 5 8
ENSDART00000131632 Essential Splice Site 293 527 5 8
Genomic Location (Zv9):
Chromosome 8 (position 24085365)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23211183
KASP Assay ID:
554-3887.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATATACTCTTGTTCTGATGTGCCTAACAGTGTTTCTCYTTATCTTCTA[G/T]ACTCTATCAACCACAGGGAGTTCATGTTGGAGACACAAATATTAAAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link