ddx26b

Ensembl ID:
ENSDARG00000017931
ZFIN ID:
ZDB-GENE-040426-1150
Description:
Integrator complex subunit 6 [Source:UniProtKB/Swiss-Prot;Acc:Q7SYD9]
Human Orthologue:
INTS6
Human Description:
integrator complex subunit 6 [Source:HGNC Symbol;Acc:14879]
Mouse Orthologue:
Ints6
Mouse Description:
integrator complex subunit 6 Gene [Source:MGI Symbol;Acc:MGI:1202397]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17765 Nonsense Available for shipment Available now
sa19085 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31994 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17765
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002684 Nonsense 219 892 6 18
ENSDART00000146587 Nonsense 219 873 6 18
Genomic Location (Zv9):
Chromosome 14 (position 32457298)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31247105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTAAGGCCGCTCTTACTGTGTAAGAACCCAAAGGATGCTGAACCAGTG[T/A]CTTGAGTCTCTCGTCCAAAAGGTGTTGAGTGGAGTTGTAATAYATTTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19085
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002684 Essential Splice Site 581 892 13 18
ENSDART00000146587 Essential Splice Site 562 873 13 18
Genomic Location (Zv9):
Chromosome 14 (position 32471672)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31261479
KASP Assay ID:
2260-7693.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAACCTTTTGAGGACAACGCAAAAGCTCATCAGAGGCCAGGATGATGG[T/G]AACTGCAGCAAAGATTCAGAATACATTTTGTCAAGTTTAATGATTTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31994
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002684 Nonsense 738 892 16 18
ENSDART00000146587 Nonsense 719 873 16 18
Genomic Location (Zv9):
Chromosome 14 (position 32475616)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 31265423
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCAGGTACTGACGCTGGAGACTGCTGGCCTGGAGAAGTGGACGGAGAAT[C/A]AGGAGAACCCGCACCTGTGGAGGACAGAGGAGACGCTGCGGCACCGGACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link