ncoa2

Ensembl ID:
ENSDARG00000017929
ZFIN ID:
ZDB-GENE-010406-3
Description:
Nuclear receptor coactivator 2 [Source:UniProtKB/Swiss-Prot;Acc:Q98TW1]
Human Orthologue:
NCOA2
Human Description:
nuclear receptor coactivator 2 [Source:HGNC Symbol;Acc:7669]
Mouse Orthologue:
Ncoa2
Mouse Description:
nuclear receptor coactivator 2 Gene [Source:MGI Symbol;Acc:MGI:1276533]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24460 Nonsense Available for shipment Available now
sa24461 Nonsense Available for shipment Available now
sa5991 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa24460
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017165 Nonsense 844 1505 12 22
ENSDART00000124181 Nonsense 844 1505 10 20
ENSDART00000124740 Nonsense 844 1505 12 22
Genomic Location (Zv9):
Chromosome 24 (position 14312882)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14264330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACATCCTGCAGATGACAGGAGAGAGCGGAGCTAACATGAGTCCTCAA[C/T]AGCAGAGAGCACTGCAGACTGCAGTCAGCCAACAGAGTGAGTAACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24461
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017165 Nonsense 1157 1505 17 22
ENSDART00000124181 Nonsense 1157 1505 15 20
ENSDART00000124740 Nonsense 1157 1505 17 22
Genomic Location (Zv9):
Chromosome 24 (position 14325289)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14276737
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACGCCAATGCAAGATGCCACTTTCCACGGCTTGCAAGGACAGATGGGA[C/T]AGAGACCCGGATACCCAATGCTCCGAATGCAAGCGAGACCGGGACTCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5991
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017165 Essential Splice Site 1197 1505 17 22
ENSDART00000124181 Essential Splice Site 1197 1505 15 20
ENSDART00000124740 Essential Splice Site 1197 1505 17 22
Genomic Location (Zv9):
Chromosome 24 (position 14325412)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 14276860
KASP Assay ID:
554-3651.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACCCAATACACTCAGACTGCAGCTTCAGCACAGGCTACAAGCACAGCAG[G/A]TACACTTTCAACACACACACAARAGYCTGAAGGAAGTAGAACAGAAGTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Cardiac Troponin-T levels: Association of genome-wide variation with highly sensitive cardiac troponin-T levels in European Americans and Blacks: a meta-analysis from atherosclerosis risk in communities and cardiovascular health studies. (View Study)
  • Metabolite levels (MHPG): Genome-wide association study of monoamine metabolite levels in human cerebrospinal fluid. (View Study)
  • Non-small cell lung cancer: Prognostic implications of genetic variants in advanced non-small cell lung cancer: a genome-wide association study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link