her7

Ensembl ID:
ENSDARG00000017917
ZFIN ID:
ZDB-GENE-000427-6
Description:
hairy and enhancer of split related-7 [Source:RefSeq peptide;Acc:NP_571684]
Human Orthologue:
HES7
Human Description:
hairy and enhancer of split 7 (Drosophila) [Source:HGNC Symbol;Acc:15977]
Mouse Orthologue:
Hes7
Mouse Description:
hairy and enhancer of split 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
hu2526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
hu2526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017849 Nonsense 37 206 2 3

The following transcripts of ENSDARG00000017917 do not overlap with this mutation:

Genomic Location:
Chromosome 5 (position 71712228)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTAGAAAGACGTAGAAGAGAAAGGATGAACCGGAGTCTAGAAAACCTG[A/T]AACTTCTGCTCCTGCAAGGCCCAGAACACAACGTAAGACCACCTTTTGCT
Associated Phenotype:

This allele has been associated with this phenotype by genetic linkage analysis and may not be causal. See FAQs for more info.

Control on left; Mutant on right; 16 hpf

Control on left; Mutant on right; 16 hpf

zoom

Control on left; Mutant on right; 72 hpf

Control on left; Mutant on right; 72 hpf

zoom

Stage Entity Quality Tag
Segmentation:10-13 somites
ZFS:0000025
somitogenesis
GO:0001756
disrupted
PATO:0001507
abnormal
PATO:0000460
Adult
ZFS:0000044
caudal vertebra
ZFA:0000326
deformed
PATO:0001617
abnormal
PATO:0000460
Adult
ZFS:0000044
whole organism
ZFA:0001094
viable
PATO:0000719
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/7vv0i933