casp3a

Ensembl ID:
ENSDARG00000017905
ZFIN ID:
ZDB-GENE-011210-1
Description:
caspase 3, apoptosis-related cysteine protease a [Source:RefSeq peptide;Acc:NP_571952]
Human Orthologue:
CASP3
Human Description:
caspase 3, apoptosis-related cysteine peptidase [Source:HGNC Symbol;Acc:1504]
Mouse Orthologue:
Casp3
Mouse Description:
caspase 3 Gene [Source:MGI Symbol;Acc:MGI:107739]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3346 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000005593 Essential Splice Site 106 282 4 7
ENSDART00000131927 Essential Splice Site 106 206 3 5
ENSDART00000139702 Essential Splice Site 106 151 4 5
ENSDART00000140076 Essential Splice Site 80 120 3 4
Genomic Location:
Chromosome 1 (position 16273193)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCTACAATGACCAGACAGTWGCGCAGATTATGCAGGTTTTAACAACAGG[T/C]AGTYATTATACRCTGARCACAAACAATTAAAAGARAACATATGTTATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rxbq6kh2