tln2

Ensembl ID:
ENSDARG00000017901
ZFIN ID:
ZDB-GENE-040724-263
Description:
Putative uncharacterized proteinZgc:152648 [Source:UniProtKB/TrEMBL;Acc:Q0V975]
Human Orthologue:
TLN2
Human Description:
talin 2 [Source:HGNC Symbol;Acc:15447]
Mouse Orthologue:
Tln2
Mouse Description:
talin 2 Gene [Source:MGI Symbol;Acc:MGI:1917799]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa40914 Nonsense Mutation detected in F1 DNA During 2016
sa34090 Nonsense Mutation detected in F1 DNA During 2016
sa3330 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa40914
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018142 Nonsense 13 289 3 10
ENSDART00000134068 Nonsense 13 115 4 5
ENSDART00000136555 Nonsense 13 2157 3 49
Genomic Location:
Chromosome 7 (position 31226849)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGCCGTCAGGATGGTGGCGCTGTCTCTGAAGATCTGTGTGAGGCAGTG[T/A]AATGTGGTGAAGACCATGCAGTTTGAGCCCTCAACGGCTGTATATGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34090
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018142 Nonsense 246 289 8 10
ENSDART00000134068   None 115 None 5
ENSDART00000136555 Nonsense 246 2157 8 49
Genomic Location:
Chromosome 7 (position 31236573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCCGGTGTCGTTTGACAAGGCTTGTGAGTTTGGGGGAATTCAAACG[C/T]AGATCCAGTTCGGTCCTCATATTGAACATAAACACAAGACTGGATTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3330
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018142   None 289 None 10
ENSDART00000134068   None 115 None 5
ENSDART00000136555 Essential Splice Site 668 2157 18 49
Genomic Location:
Chromosome 7 (position 31249090)
KASP Assay ID:
554-2649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTGCTCAGACAGATTGGAGAGAATGAAACCGATGAGCGCTTCCAGG[T/A]ACACAGGCGTCTAATAAAGTATACAATGCATGACGCGTGTTTATCACCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link