tln2

Ensembl ID:
ENSDARG00000017901
ZFIN ID:
ZDB-GENE-040724-263
Description:
Putative uncharacterized proteinZgc:152648 [Source:UniProtKB/TrEMBL;Acc:Q0V975]
Human Orthologue:
TLN2
Human Description:
talin 2 [Source:HGNC Symbol;Acc:15447]
Mouse Orthologue:
Tln2
Mouse Description:
talin 2 Gene [Source:MGI Symbol;Acc:MGI:1917799]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa3330 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa3330
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018142 None None 289 None 10
ENSDART00000134068 None None 115 None 5
ENSDART00000136555 Essential Splice Site 668 2157 18 49
Genomic Location:
Chromosome 7 (position 31249090)
KASP Assay ID:
554-2649.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCTGCTCAGACAGATTGGAGAGAATGAAACCGATGAGCGCTTCCAGG[T/A]ACACAGGCGTCTAATAAAGTATACAATGCATGACGCGTGTTTATCACCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ivjob901