tcp1

Ensembl ID:
ENSDARG00000017891
ZFIN ID:
ZDB-GENE-990714-24
Description:
T-complex protein 1 subunit alpha [Source:RefSeq peptide;Acc:NP_571305]
Human Orthologue:
TCP1
Human Description:
t-complex 1 [Source:HGNC Symbol;Acc:11655]
Mouse Orthologue:
Tcp1
Mouse Description:
t-complex protein 1 Gene [Source:MGI Symbol;Acc:MGI:98535]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7506 Missense Mutation detected in F1 DNA During 2014
sa12092 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa7506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126038 Missense 65 558 3 12
Genomic Location:
Chromosome 23 (position 2440140)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKCTTGTGTGTTTCAGGACGTGACCATCACCAATGACGGGGCCACCATCC[T/C]GAAGCTGCTGGAGGTCGAACACCCGGCTGCTAAAGTCCTCTGTGAGCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12092
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126038 Essential Splice Site 328 558 8 12
Genomic Location:
Chromosome 23 (position 2452272)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGAGTCCTGAAGAAAGACCTCAARCGCATYGCTAAAGCTACTGGAGG[T/C]CTGCTKAATTAACCTGCTCGCTTTACTCTGGTGTGTGCATTAGTGATYGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8rjvomzo