bgn

Ensembl ID:
ENSDARG00000017884
ZFIN ID:
ZDB-GENE-040704-74
Description:
biglycan [Source:RefSeq peptide;Acc:NP_001002227]
Human Orthologue:
BGN
Human Description:
biglycan [Source:HGNC Symbol;Acc:1044]
Mouse Orthologue:
Bgn
Mouse Description:
biglycan Gene [Source:MGI Symbol;Acc:MGI:88158]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa34346 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34346
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027225 Nonsense 31 369 2 8
Genomic Location (Zv9):
Chromosome 8 (position 14638473)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 14083817
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACCTACCAATATACTCCAGTGCTCTTCCCTTCGAGCAGAAAGGATTCT[G/A]GGACTTTGGCAAAGATATCGATGTGAAAGAGCTGATGATGATGATGGACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link