rdh1

Ensembl ID:
ENSDARG00000017882
ZFIN ID:
ZDB-GENE-030912-15
Description:
retinol dehydrogenase 1 [Source:RefSeq peptide;Acc:NP_932335]
Human Orthologue:
RDH5
Human Description:
retinol dehydrogenase 5 (11-cis/9-cis) [Source:HGNC Symbol;Acc:9940]
Mouse Orthologue:
Rdh5
Mouse Description:
retinol dehydrogenase 5 Gene [Source:MGI Symbol;Acc:MGI:1201412]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34767 Nonsense Mutation detected in F1 DNA During 2017
sa7214 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa34767
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026210 Nonsense 249 327 4 5
Genomic Location (Zv9):
Chromosome 9 (position 49732157)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48987353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCTGAAGAAACGCTGGAGTAATCTTCCAGAACAGGTCAGAAGAGACTAC[G/T]GAGACTCCTACCTGCAGGAATGTGAGTACAATCAGATGATGGAGTAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7214
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026210 Essential Splice Site 255 327 4 5
Genomic Location (Zv9):
Chromosome 9 (position 49732135)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 48987331
KASP Assay ID:
554-4984.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
WCTTCCAGAACAGGTCAGAAGAGACTACGGAGACTCCTACCTGCAGGAAT[G/A]TGAGTACAATCAGATGATGGAGYAATGCAAATTCATAAATGTAAACATCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link