prkri

Ensembl ID:
ENSDARG00000017874
ZFIN ID:
ZDB-GENE-000831-4
Description:
protein-kinase, interferon-inducible double stranded RNA dependent inhibitor [Source:RefSeq peptide
Human Orthologue:
DNAJC3
Human Description:
DnaJ (Hsp40) homolog, subfamily C, member 3 [Source:HGNC Symbol;Acc:9439]
Mouse Orthologue:
Dnajc3
Mouse Description:
DnaJ (Hsp40) homolog, subfamily C, member 3 Gene [Source:MGI Symbol;Acc:MGI:107373]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20911 Essential Splice Site Available for shipment Available now
sa20910 Nonsense Available for shipment Available now
sa31565 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20911
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Essential Splice Site 111 500 None 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21960153)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20550589
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTGCCGGATCTGACCCAAGCCATACAGCTCAAGCCAGACTTTCTTGCTG[T/A]GAGTTCATTTTTGTTGTTGTAATACAAAATTGAGTTCTATGTGGCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20910
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Nonsense 123 500 4 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21960034)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20550470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGCATATGTTTTCAGGCCAGACTGCAGAGGGGTAATATTCTTCTGAAA[C/T]AAGGAAGTACTCAAGAGGCCAGAGAGGACTTCCAAGCAGTTGTGAGTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31565
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026098 Nonsense 168 500 5 12

The following transcripts of ENSDARG00000017874 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 7 (position 21959336)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20549772
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGGCTGATAAGCTGGAGTCTCTCCAGGAAGAGGCGCATGAAGCTCAT[C/T]GACGTGGAGACTGCAGGATTGCTGTCCAGGTGCTGGAGCATGTCATAGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link