rgs5b

Ensembl ID:
ENSDARG00000017860
ZFIN ID:
ZDB-GENE-050417-359
Description:
regulator of G-protein signaling 16 [Source:RefSeq peptide;Acc:NP_001017821]
Human Orthologues:
RGS16, RGS8
Human Descriptions:
regulator of G-protein signaling 16 [Source:HGNC Symbol;Acc:9997]
regulator of G-protein signaling 8 [Source:HGNC Symbol;Acc:16810]
Mouse Orthologues:
Rgs16, Rgs8
Mouse Descriptions:
regulator of G-protein signaling 16 Gene [Source:MGI Symbol;Acc:MGI:108407]
regulator of G-protein signaling 8 Gene [Source:MGI Symbol;Acc:MGI:108408]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19668 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016607 Essential Splice Site 58 171 2 4
Genomic Location (Zv9):
Chromosome 2 (position 6591451)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 7015021
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTGTTATTGGAGGACAGACAATCTTTTCACGAACTGCTGCTTCACAAAG[G/T]TGAGTTTAATAAAAATTAATAGCGTTTCCTTCTCAGGCTGCAGCACCAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link