prepl

Ensembl ID:
ENSDARG00000017853
ZFIN ID:
ZDB-GENE-090313-224
Description:
prolyl endopeptidase-like [Source:RefSeq peptide;Acc:NP_001139088]
Human Orthologue:
PREPL
Human Description:
prolyl endopeptidase-like [Source:HGNC Symbol;Acc:30228]
Mouse Orthologue:
Prepl
Mouse Description:
prolyl endopeptidase-like Gene [Source:MGI Symbol;Acc:MGI:2441932]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22235 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22235
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008603 Nonsense 205 692 5 14
Genomic Location (Zv9):
Chromosome 13 (position 10189292)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 10491621
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCCGTCTTCATCTCATTGATTCTGCTGTCCAAACCACACTTGTTTA[T/A]GAGGAAAAAGATCCAAAGTAAGACCATTGTGTCCTGGTGTGATAAAATTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link