cand1

Ensembl ID:
ENSDARG00000017841
ZFIN ID:
ZDB-GENE-040426-2872
Description:
cullin-associated NEDD8-dissociated protein 1 [Source:RefSeq peptide;Acc:NP_998650]
Human Orthologue:
CAND1
Human Description:
cullin-associated and neddylation-dissociated 1 [Source:HGNC Symbol;Acc:30688]
Mouse Orthologue:
Cand1
Mouse Description:
cullin associated and neddylation disassociated 1 Gene [Source:MGI Symbol;Acc:MGI:1261820]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20236 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa20236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000003694 Essential Splice Site 164 1230 4 15
Genomic Location:
Chromosome 4 (position 12479864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTCGGTTCAGCTGGAAGCATTGGACATCATGGCAGACATGCTGTGCAG[G/A]TATGTCAGATGAGGCATGTGATGACTGCTGCTTTTGTTTCAACCAATTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Hippocampal atrophy: Hippocampal atrophy as a quantitative trait in a genome-wide association study identifying novel susceptibility genes for Alzheimer's disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5hqkc5yx