Q7ZUX0_DANRE

Ensembl ID:
ENSDARG00000017834
Description:
Zgc:55983 [Source:UniProtKB/TrEMBL;Acc:Q7ZUX0]
Human Orthologue:
MICAL1
Human Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 [Source:HGNC Symbol;Acc:20
Mouse Orthologue:
Mical1
Mouse Description:
microtubule associated monoxygenase, calponin and LIM domain containing 1 Gene [Source:MGI Symbol;Ac

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7303 Essential Splice Site Mutation detected in F1 DNA During 2017
sa31192 Nonsense Available for shipment Available now
sa38246 Nonsense Mutation detected in F1 DNA During 2017
sa39551 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7303
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008682 Essential Splice Site None 562 1 19
ENSDART00000132952   None 448 None 15
ENSDART00000137821   None 702 None 16

The following transcripts of ENSDARG00000017834 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8562130)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8801935
KASP Assay ID:
554-4901.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCAGGAGTTTCAGGGATTTCTTAACTGCAGCTGACGGTGAAATTAGTG[G/A]TGAGTGTTTGTGTGTGTGAGAGATTAAGCAAAAWTCCTTCAGCATTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31192
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008682 Nonsense 512 562 9 19
ENSDART00000132952 Nonsense 398 448 5 15
ENSDART00000137821 Nonsense 401 702 5 16

The following transcripts of ENSDARG00000017834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8548092)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8787897
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGAAGAGCTTATCCAGGAATGTGAACACACCGTCATCTAACAGCAAG[G/T]GTGAGGAACACTGACTTACCTGTGCTTTTACTGTACATGCACTGATGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38246
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008682   None 562 15 19
ENSDART00000132952   None 448 11 15
ENSDART00000137821 Nonsense 596 702 12 16

The following transcripts of ENSDARG00000017834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8542131)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8781936
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCAGAAACAAGCAGGTCTACATGAGACGGGAGTCTGAGCTTGTTTA[T/A]ATGTAAGAGTGCATAATCTCTCTGCATTGCTGCGTTAATGTTGACTCCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008682   None 562 19 19
ENSDART00000132952   None 448 15 15
ENSDART00000137821 Nonsense 691 702 16 16

The following transcripts of ENSDARG00000017834 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8537032)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8776837
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGATATGAAGAAGGAAAAGGTCAAGAAGATGTCTCCAGTAACTCGATG[G/A]TTTAGCATGAGAAAACGGAGGTCTTCAGAAGATTGATCGTCTTGTAGTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link