gata5

Ensembl ID:
ENSDARG00000017821
ZFIN ID:
ZDB-GENE-980526-340
Description:
transcription factor GATA-5 [Source:RefSeq peptide;Acc:NP_571310]
Human Orthologue:
GATA5
Human Description:
GATA binding protein 5 [Source:HGNC Symbol;Acc:15802]
Mouse Orthologue:
Gata5
Mouse Description:
GATA binding protein 5 Gene [Source:MGI Symbol;Acc:MGI:109497]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24255 Nonsense Available for shipment Available now
hu3392 Essential Splice Site Available for shipment Available now
sa17489 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24255
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012194 Nonsense 50 383 2 7
Genomic Location:
Chromosome 23 (position 7454465)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCACTCGTGTACCAGCCATGCTCCAGACCTTGCCCTACCTACAGACTTG[C/A]GAGTCCAGCCACCAAGCCCATGGGATCAGCAGTCACCACGCCTGGCCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu3392
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012194 Essential Splice Site 174 383 2 7
Genomic Location:
Chromosome 23 (position 7454837)
KASP Assay ID:
554-0409.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTCTTCAGGGACGCCAGGGAACTCTACCGGGAAGGAGGTCCAGTATAGG[T/C]AAAAATCTTAACATGTTTTTGCCTTCTCATTTTTTTCTGTCTGGATATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17489
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012194 Nonsense 346 383 7 7
Genomic Location:
Chromosome 23 (position 7463766)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATATRCATTGTCAGCTGACAGSAWTTCCCTGTGCTCTTTCTAAGGCAT[C/A]RACACARTTGGATAGTGCMAGTTCTGCCCATGTGGACATCAAATATGAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/hv2pkv49