traf2b

Ensembl ID:
ENSDARG00000017812
ZFIN ID:
ZDB-GENE-030131-5345
Description:
Novel protein similar to vertebrate TNF receptor-associated factor 2 (TRAF2) [Source:UniProtKB/TrEMB
Human Orthologue:
TRAF2
Human Description:
TNF receptor-associated factor 2 [Source:HGNC Symbol;Acc:12032]
Mouse Orthologue:
Traf2
Mouse Description:
TNF receptor-associated factor 2 Gene [Source:MGI Symbol;Acc:MGI:101835]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17008 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074731 Nonsense 9 532 1 10
ENSDART00000146296 Nonsense 9 532 2 11
Genomic Location:
Chromosome 5 (position 63021300)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGTTGTGGTCTACRTTTTTMYAGATGATCAGCGCTGCAGGCAYTCTGTG[T/A]AAATGGAAGGATATGGAACGWCCATCTTTACCATCTTCTCTGGACTCAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g3m3bw5x