LOC100334173

Ensembl ID:
ENSDARG00000017799
Human Orthologue:
TGM1
Human Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Mouse Orthologue:
Tgm1
Mouse Description:
transglutaminase 1, K polypeptide Gene [Source:MGI Symbol;Acc:MGI:98730]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24240 Nonsense Mutation detected in F1 DNA During 2014
sa5020 Essential Splice Site Mutation detected in F1 DNA During 2014
sa19310 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24241 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa24240
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Nonsense 8 734 1 13
Genomic Location:
Chromosome 23 (position 1754846)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGACTGGTACTCTCAAACCAGAGGATATGGAGAAAACGGAGCAGAAAT[G/A]GTCCTGTGGTGCATGGTTTCGGCAGTGTTGCTGCTCCTGCCGAAAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5020
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Essential Splice Site 377 734 7 13
ENSDART00000002690 Essential Splice Site 377 734 7 13
Genomic Location:
Chromosome 23 (position 1765142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGGATGAGAACCATGAGCTGATCGAGGAGCTTTGCAGCGATTCTGTCTG[G/A]TTAGCTCACATTTTAACAAAYATTTTCACTTCAACAGCATCATCAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19310
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Essential Splice Site 377 734 7 13
ENSDART00000002690 Essential Splice Site 377 734 7 13
Genomic Location:
Chromosome 23 (position 1765142)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGGATGAGAACCATGAGCTGATCGAGGAGCTTTGCAGCGATTCTGTCTG[G/A]TTAGCTCACATTTTAACAAACATTTTCACTTCAACAGCATCATCAAAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24241
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Essential Splice Site 687 734 12 13
Genomic Location:
Chromosome 23 (position 1769909)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCATTGAAGGACTGGGGCTGCAGCACGTCAGAGAGATTTCACACGGG[T/C]AAGTTTACCATAGTAATAATACACAAGGTCACTTTTGTATTTGCTCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/1voduvfi