LOC100334173

Ensembl ID:
ENSDARG00000017799
Human Orthologue:
TGM1
Human Description:
transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase) [So
Mouse Orthologue:
Tgm1
Mouse Description:
transglutaminase 1, K polypeptide Gene [Source:MGI Symbol;Acc:MGI:98730]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24240 Nonsense Available for shipment Available now
sa29859 Essential Splice Site Mutation detected in F1 DNA During 2016
sa37593 Essential Splice Site Mutation detected in F1 DNA During 2016
sa29860 Nonsense Mutation detected in F1 DNA During 2016
sa24241 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24240
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Nonsense 8 734 1 13
Genomic Location (Zv9):
Chromosome 23 (position 1754846)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1723031
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGACTGGTACTCTCAAACCAGAGGATATGGAGAAAACGGAGCAGAAAT[G/A]GTCCTGTGGTGCATGGTTTCGGCAGTGTTGCTGCTCCTGCCGAAAATCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Essential Splice Site 48 734 1 13
Genomic Location (Zv9):
Chromosome 23 (position 1754967)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1723152
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACACGCTGCTAATACAACCGCAGAAAAAACAGAGACACCAGCCACAGG[T/A]AAACTAACACACGAGGGAGAAATATTATTAGAACTATTATCATTCACTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37593
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Essential Splice Site 236 734 5 13
Genomic Location (Zv9):
Chromosome 23 (position 1761640)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1729825
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCATGCAGTATAAAGTTACTAACTTCTTCATCCATGTTTCTGTCTCTTA[G/A]TTTGATAAAAGCATCCTTCCCGCGTGTCTGTTTCTGCTGGAGCGCAGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29860
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Nonsense 514 734 10 13
Genomic Location (Zv9):
Chromosome 23 (position 1767911)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1736096
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCATTGCAGTGGAAACAGCCGTTCAGCATGGCTCTAAAGCTGGACTCTA[C/A]GAAATCTCCAGTGTTAACGACGTCAGTATTGAGATCTCGATGGATGGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24241
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002690 Essential Splice Site 687 734 12 13
Genomic Location (Zv9):
Chromosome 23 (position 1769909)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 1738094
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCGCATTGAAGGACTGGGGCTGCAGCACGTCAGAGAGATTTCACACGGG[T/C]AAGTTTACCATAGTAATAATACACAAGGTCACTTTTGTATTTGCTCAAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link